circad | circRNAs associated with diseases

circ_0067934
Gene	PRKCI	Organism	Human
Genome Locus	chr3:170013698-170015181:+	Build	hg19
Disease	Thyroid Carcinoma	ICD-10	Malignant neoplasm of skin, unspecified (C44.9)
DBLink	Link to database	PMID	30779728
Experimental Method
Sample Type	Tissue and cell lines	Comparison	A total of 57 thyroid cancer tissue samples and paracancer tissue samples were collected
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TAGCAGTTCCCCAATCCTTG Reverse CACAAATTCCCATCATTCCC	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Wang, H, Yan, X, Zhang, H, Zhan, X (2019). CircRNA circ_0067934 Overexpression Correlates with Poor Prognosis and Promotes Thyroid Carcinoma Progression. Med. Sci. Monit., 25:1342-1349.